Plant Gene and Trait 2026, Vol.17, No.1, 1-11 http://genbreedpublisher.com/index.php/pgt 9 Figure 5 Amplification and detection of primers 4, 18, SF3, SF14, SF4, SF12 and SF13 Note: 1~8 The number of strains; M: 50bp DNA ladder Table 6 Information of microsatellite primers used in this study Locus name Dye Primer sequence (5´-3´) Tm (℃) Allele size (bp) Repeated motif SF12 5`6-FAM F:AAACGAATGAGGCTGAATGG 58 150-200 (AT)6 R:GGATGCACGCAATTTTCTTT SF3 5`6-FAM F:GAGAGCTCTGCTGCCATCTT 58 150 (TC)6 R:ATAACGTTCCCTGGCATCTG SF4 5`6-FAM F:ATAAAAAGTCCCCGGAGCAT 58 100-150 (AG)9 R:GCCAGTGAAATTGAGGTTGC 18 5`6-FAM F:ACATTGATTTGCATTGGGGT 58 200-250 (CA)6 R:AGAGCACATTCCGGTACCAC SF13 5`HEX F:ACGGCCTTTGTTTTCTCTCA 58 250-300 (GT)7 R:AAACCGCCAACACAGGTAAT SF14 5`HEX F:CTTCGTCCCCGATACAAGAG 58 200-300 (CAG)6 R:CATCATGCCCGATATCATCA 4 5`HEX F:AGTGAGAGCACCTGCTGGAT 58 300 (TTC)5/(GGGTAAA)3 R:AGCAGTGGGCTTTACCCTTT Table 7 The PCR reaction system of the microsatellite markers Component Volume (μL) (Vazyme)2×Taq Master mix 12.5 Forward primer 1.5 Reverse primer 1.5 ddH2O 6 DNA template 1.5 Total 20 The PCR reaction program was as follows: 94 °C for 3 min; 30 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min; followed by a final extension at 72 °C for 5 min, and then held at 4 °C. After completion of the PCR reactions, the products were examined by electrophoresis on 3% agarose gels. Qualified PCR amplification products were sent to an automated sequencer (Applied Biosystems) for allele genotyping. GeneMarker software was used to read allele sizes, and genotyping results were obtained for 100 Platycladus orientalis individuals.
RkJQdWJsaXNoZXIy MjQ4ODYzNA==